| 產品名稱 | Trichophyton interdigitale Priestley |
|---|---|
| 商品貨號 | B167643 |
| Deposited As | Trichophyton interdigitale Priestley |
| Strain Designations | 640 [Emmons 640, NIH 640, QM 248] |
| Application | Efficacy testing Media testing Testing antimicrobial agent Testing disinfectants Biomedical Research and Development Material Food testing |
| Biosafety Level | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Comments | The strain was re-identified as Trichophyton interdigitale in the Trichophyton mentagrophytes species complex based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests. |
| Morphology | After 3 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, dense, velutinous; reverse orange. Microconidia abundant, hyaline, tear-drop shaped, formed alongside the hyphae. Macroconidia cigar shaped, hyaline, smooth-walled, 2-3 septate. |
| Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 307: Cornmeal agar |
| Growth Conditions | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTACTCCTCGTCTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC beta-tubulin (TUB2) gene CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAGCGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCGTTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAGCACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTTGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG |
| Name of Depositor | CW Emmons |
| Special Collection | ATCC |
| Isolation | Clinical specimen - human, 1943 |
| Cross References | Nucleotide (GenBank) : KJ606115 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KJ606163 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : KJ606211 beta-tubulin (TUB2) gene |
| References | AOAC International Fungicidal activity of disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 955.17. Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3. US General Services Administration Disinfectant, general purpose (liquid phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1438A, 1997 US General Services Administration Disinfectant-detergent, general purpose (phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1439A, 1998 US General Services Administration Disinfectant-detergent, general purpose (iodophor). Washington, DC:US General Services Administration;Commercial Item Description A-A-1440, 1981 US General Services Administration Disinfectant, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1441B, 2005 US General Services Administration Disinfectant-detergent, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1443A, 1998 AOAC International Germicidal spray products as disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.02. human tinea pedis Standard Quantitative Carrier Test Method to Evaluate the Bactericidal, Fungicidal, Mycobactericidal, and Sporicidal Potencies of Liquid Chemical Microbicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2111-05. Standard Quantitative Disk Carrier Test Method for Determining the Bactericidal, Virucidal, Fungicidal, Mycobactericidal and Sporicidal Activities of Liquid Chemical Germicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2197-02. Standard Practice for Evaluation of Pre-saturated or Impregnated Towelettes for Hard Surface Disinfection . West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2362-04. Suh SO, Grosso KM, Carrion ME. Multilocus phylogeny of the Trichophyton mentagrophytes species complex and the application of MALDI-TOF mass spectrometry for the rapid identification of dermatophytes. Mycologia 110: 118-130, 2018. PubMed: 29863990 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |

