| 產品名稱 |
Phaeotremella skinneri (Phaff et Carmo Souza) Yurkov et Boekhout |
| 商品貨號 |
B170170 |
| Deposited As |
Cryptococcus skinneri Phaff et do Carmo-Sousa |
| Strain Designations |
UCD 60-82 [CBS 5029, CCRC 21577, DBVPG 6011, IFO 1872, JCM 9039, MUCL 30437, NRRL Y-5851] |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Preceptrol® |
no |
| Genome Sequenced Strain |
Yes
|
| Comments |
Genome sequencing strain (RIKEN Center for Life Science Technologies, Japan) |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
|
| Growth Conditions |
Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
AGGTGAACCTGCGGAAGGATCATTAGAGATGTGCGCAAGCACTTTTCCCTTCACACACCTGTGCACCGTGGTCTCCGGACCTACAAACATGAAGTCATGAACGTCTTATTATTATAACAAAATAAAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATGAAAATCTCATCCCATCGGGTTTCCGATGATGATGGACTTGGGTGTTGCCGTCCTTGGCTCGCCTTAAAGGTGTTAGCGGTTCCGAAGTCGAATCTGGCGTAATAAGTTTCGCTGGCCTAGATCGAAGGCTGCTCCTAACCCGTCTTCTGACATTTTTTGCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT
|
| Name of Depositor |
HJ Phaff |
| Isolation |
Insect frass, Tsuga heterophylla, Oregon |
| Cross References |
Nucleotide (GenBank) :
AF189835
26S ribosomal RNA gene, partial sequence
Nucleotide (GenBank) :
EU252549
ITS including 5.8S rRNA gene
Nucleotide (GenBank) :
BCHT00000000
Cryptococcus skinneri strain JCM 9039, whole genome shotgun sequencing project
|
| References |
Phaff HJ, do Carmo-Sousa L. Four new species of yeast iosolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent. Antonie van Leeuwenhoek 28: 193-207, 1962.
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Liu XZ, et al. Phylogeny of tremellomycetous yeasts and related dimorphic and filamentous basidiomycetes reconstructed from multiple gene sequence analyses. Stud Mycol 81: 1-26, 2015. PubMed: 26955196
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
Takashima M, Nakase T. Molecular phylogeny of the genus Cryptococcus and related species based on the sequences of 18S rDNA and internal transcribed spacer regions. Microbiol Cult Collect 15: 35-47, 1999.
|
