| 產(chǎn)品名稱 |
Fusarium venenatum Nirenberg |
| 商品貨號(hào) |
B171423 |
| Deposited As |
Fusarium graminearum Schwabe |
| Strain Designations |
I 0/5 [A 3/5, IMI 145425, NRRL 26139] |
| Application |
Produces alkaline protease
Produces single-cell protein SCP
Transformation host
Produces edible mycoprotein |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain |
no |
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® |
no |
| Comments |
Taxonomy |
| Morphology |
After 13 days on Malt agar medium at 30°C, colonies are restricted, heaped, pale orange. No sporulation observed. After 7 days on Emmons' modification of Sabouraud's agar at room temperature with a natural day/night cycle, colony is thick, velutinous, pale orange. Macroconidia abundant, falcate, 5-septate. |
| Medium |
ATCC® Medium 323: Malt agar medium
ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
|
| Growth Conditions |
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTCTATGTTGCCTCGGCGGATCAGCCCGTTCCTCACGGAACGGCCCGCCGCAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAAAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTTTTAGTTAACACTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGACGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTTCGGGCCCGAGTTGTAATTTGTAGAGGATGACTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAGTCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCGCCGGGGGATAAAGACTTCGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGCGGGGACTGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC
|
| Name of Depositor |
RHM Res., Ltd. |
| U.S. Patent Number |
|
| Chain of Custody |
ATCC <-- RHM Res., Ltd. <-- G Scammell |
| Isolation |
Soil, United Kingdom |
| Cross References |
Nucleotide (GenBank) :
EU853843
ITS including 5.8S rRNA gene
Nucleotide (GenBank) :
FJ746660
ITS including 5.8S rRNA gene
|
| References |
Solomons GL, Scamml GW. Production of edible protein substances. US Patent 3,937,654 dated Feb 10 1976
Towersey PJ, et al. Production of edible protein containing substances. US Patent 3,937,693 dated Feb 10 1976
. . Milchwissenschaft 47: 147-148, 1992.
Royer JC, et al. Fusarium graminearum A 3/5 as a novel host for heterologous protein production. Bio-Technology 13: 1479-1483, 1995. PubMed: 9636307
O'Donnell K, et al. Molecular phylogenetic, morphological, and mycotoxin data support reidentification of the Quorn mycoprotein fungus as Fusarium venenatum. Fungal Genet. Biol. 23: 57-67, 1998. PubMed: 9501477
Yoder WT, Christianson LM. Species-specific primers resolve members of Fusarium section Fusarium. Taxonomic status of the edible "Quorn" fungus reevaluated. Fungal Genet Biol 23: 68-80, 1998. PubMed: 9501478
|