| 產(chǎn)品名稱(chēng) |
MCP-1 |
| 商品貨號(hào) |
B182313 |
| Designations |
MCP-1 |
| Species |
Homo sapiens, human |
| Depositors |
M Mehrabian |
| Applications |
A full-length cDNA clone derived as a PCR product from monocyte cDNA. The oligonucleotides used were: 5' CTAACCCAGAAACATCCAATTCTC 3' and 5' GGTGTAATAGTTACAAAATATTCA 3'. |
| Vector |
Construct size (kb): 3.400000095367432 |
| Insert |
DNA: cDNA Insert lengths(kb): 0.7379999756813049 Tissue: monocyte Gene product: cytokine A2, small inducible( monocyte chemotactic protein, monocyte chemotactic protein 1, homologous to mouse Sig-je, small inducible cytokine A2, small inducible cytokine subfamily A (Cys-Cys), member 2, small inducible gene JE) [JE*] |
| Insert Size (kb) |
0.738 |
| Media |
ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
|
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: freeze-dried |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI/BamHI--2.7, 0.7; HindIII--3.4; BglII--3.4; PstI--3.0, 0.4; EcoRI/HindIII--2.7, 0.7. The insert contains the following restriction sites (nt from the 5' end): BglII--178, 271; BalI--204; PstI--382. Detects a human genomic HindIII fragment of 4.6 kb. A full-length cDNA clone derived as a PCR product from monocyte cDNA. The oligonucleotides used were: 5' CTAACCCAGAAACATCCAATTCTC 3' and 5' GGTGTAATAGTTACAAAATATTCA 3'. Does not cross-hybridize to mouse DNA at 65C, 0.1 X SSC, 0.1% SDS. |
| References |
Mehrabian M, et al. Localization of monocyte chemotactic protein-1 gene (SCYA2) to human chromosome 17q11.2-q21.1. Genomics 9: 200-203, 1991. PubMed: 2004761
Yoshimura T, et al. Human monocyte chemoattractant protein-1 (MCP-1). Full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett. 244: 487-493, 1989. PubMed: 2465924
Margarete Mehrabian, personal communication
|