| 產(chǎn)品名稱 |
Microsporomyces pini (Pohl et al.) Wang et al. |
| 商品貨號(hào) |
B196100 |
| Deposited As |
Rhodotorula pini |
| Strain Designations |
CBS 10735 [UOFS Y2513, NRRL Y-48410] |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Preceptrol® |
no |
| Comments |
Limonene-utilizing yeast |
| Morphology |
On YM agar after 10 days at 25°C, Colonies pale orange, mucoid, smooth. Cells elongated ellipsoid, smooth, hyaline, 6-12 μm x 3-6 μm. Pseudohyphae abundant. |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
|
| Growth Conditions |
Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TTAAGATATGGTCGGTCCCGGCTGGAAACCGTCGGGATAAGTATCTGTACTGTTGCATAACGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATGCAAGGGTGCTCTTTTTAGAGACCCGACCCATCTCATTTTCTCACACCGTGCACACACTTCTTTACACCATTTTAAACACAAGTCTTAAGAATGTAATCAAGTCTCGTAATTGAGCATAAAAGTTATACAACTTTCGGCAACGGATCTCTTGGCTCCCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGTCTGTTTGAGTGTCGTGAAACTCTCAACCCCCCTGTTTTGTAATGAGGCAGGCGCTTGGGCTTGGATTATGGCTGCTGTCGGACCCGAGAGGGACCGGCTCGGCTGAAATACATGAGTGTACCCTGCCTTCAGACGGCAGCGGCTTGACTCGGCGTAATAATACTATTCGCTGGGGACGCTGCATTGATGTCTGGACCGTGGACGCTTCTAATGCTTCGACGTAGTCGAAACCTTACCTTCTAGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGG
|
| Name of Depositor |
J Albertyn |
| Special Collection |
ATCC |
| Chain of Custody |
ATCC <-- J Albertyn <-- VN Thanh |
| Isolation |
Pine litter, Bloemfontein, South Africa |
| Cross References |
Nucleotide (GenBank) :
JN882335
ITS including 5.8S rRNA gene
|
| References |
Pohl CH, Smit MS, Albertyn J. Rhodotorula bloemfonteinensis sp. nov., Rhodotorula eucalyptica sp. nov., Rhodotorula orientis sp. nov., and Rhodotorula pini sp. nov., yeasts isolated from monoterpene rich environments. Int. J. Syst. Evol. Microbiol. 61: 2320-2327, 2011.
Wang QM, et al. Phylogenetic classification of yeasts and related taxa within Pucciniomycotina. Stud Mycol 81: 149-189, 2015. PubMed: 26951631
|
