Restriction digests of the clone give the following sizes (kb): EcoRI/XbaI--3.0, 0.7; BamHI--2.9, 0.35, 0.3; HindIII--2.9, 0.65; PstI--3.7; PvuII--2.4, 0.7, 0.5. The insert includes the following restriction sites (approximate kb from the 5' end): BamHI--0.06, 0.4, 0.41; PvuII--0.2; HindIII--0.63. Includes the complete coding region (nt 27-554), the complete 3' untranslated region, and 27 nt of the 5' untranslated region. The amplification product from the primers AACCGACTCTGCATTCATCTAGCCACAATG and CACTAGTCGACTCGAGT(15) was cloned into the SmaI site. The initiation ATG is at the 3' end of the upstream primer and at the 5' end of the sequence record. |
