| 產品名稱 |
pCDM9 [NEB 848] |
| 商品貨號 |
B206203 |
| Designations |
pCDM9 [NEB 848] |
| Species |
Arthrobacter luteus Kaneko et al. |
| Depositors |
New England Biolabs, Inc., I Schildkraut, New England Biolabs, Inc. |
| Applications |
produces protein modification methylase AluI produces protein restriction endonuclease AluI |
| Vector |
Construct size (kb): 7.949999809265137 |
| Insert |
DNA: genomic Insert lengths(kb): 1.75 Gene product: modification methylase AluI [aluIM] Target Gene: modification methylase AluI, restriction endonuclease AluI |
| Insert Size (kb) |
1.75 |
| Media |
LB + ampicillin (50 mcg/ml) + kanamycin (50 mcg/ml) + chloramphenicol (30 mcg/ml)
|
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Shipped: ?Freeze dried E. coli containing the plasmids |
| Comments |
Restriction digests of pCDM9 give the following sizes (kb): BamHI--9.4; BamHI/NcoI--7.0, 2.3; PstI--9.4. Restriction digests of pCDH104 give the following sizes (kb): BamHI--4.6, 1.2, 0.66 (doublet); BamHI/NcoI--2.3 (doublet), 1.2, 0.66 (doublet); PstI--4.6, 3.0. pCDH104 was constructed from a PCR product amplified using the following primers incorporating, respectively, NcoI and BamHI-EcoRI sites: 5'GAACAGACCATGGGATCAATCGTCGTTGAC3' and 5'GCAATGGATCCGAATTCCTCTGAAGCTTGACAGCTC3'. |
| References |
Xu SY, Nwankwo DO. Method for cloning and producing the AatII and AluI restriction endonuclease and methylase and related method for overexpressing restriction endonuclases. US Patent 5,405,768 dated Apr 11 1995
|
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |